Streptococcus sp. VT 162: V470_07865 Help Entry V470_07865        CDS       T03287                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism stv  Streptococcus sp. VT 162 Pathway stv01100   Metabolic pathways stv01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:stv00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     V470_07865    00074 Mycolic acid biosynthesis     V470_07865   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     V470_07865 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Motif Other DBs NCBI-ProteinID:  AHZ48330 LinkDB All DBs Position complement(1573142..1573366) Genome browser AA seq 74 aa AA seqDB search MAVFEKVQEIIVEELGKDASEVTLESTFDDLDADSLDLFQVISEIEDAFDIQIEAEDNLK TVGDLVAYVEEQTK NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atggcagtatttgaaaaagtacaagaaattatcgttgaagaacttgggaaagacgcatca gaagtaacacttgaatctacttttgatgatttggatgcagattcattggacttgttccaa gtaatctctgaaatcgaagatgctttcgatatccaaatcgaagcagaagataacttgaaa acagttggtgacttggttgcctacgttgaagagcaaacaaaataa

DBGET integrated database retrieval system