Streptococcus suis JS14 (serotype 14): SSUJS14_1617 Help Entry SSUJS14_1617      CDS       T02024                                  Name (GenBank) nucleoid DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism sui  Streptococcus suis JS14 (serotype 14) Brite KEGG Orthology (KO) [BR:sui00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:sui03032]     SSUJS14_1617    03036 Chromosome and associated proteins [BR:sui03036]     SSUJS14_1617    03400 DNA repair and recombination proteins [BR:sui03400]     SSUJS14_1617 DNA replication proteins [BR:sui03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     SSUJS14_1617 Chromosome and associated proteins [BR:sui03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     SSUJS14_1617 DNA repair and recombination proteins [BR:sui03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       SSUJS14_1617 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG DUF2267 HU-CCDC81_euk_2 Rpf1_C Motif Other DBs NCBI-ProteinID:  ADV70677 LinkDB All DBs Position complement(1601671..1601940) Genome browser AA seq 89 aa AA seqDB search MANKQDLIAKVAEATSLTKKDSAAAVDAVFGAVADYLAAGEKVQLIGFGNFEVRERSART GRNPQTGAEIKSQHLKYLLSKLVKHLKTL NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atggctaataaacaagatttgattgcaaaagttgcagaagcaacttcattgactaaaaaa gactcagcagcagctgttgatgcagtattcggagcagtagcagactaccttgcagctggt gaaaaagtacaattgatcggtttcggtaactttgaagttcgtgagcgttcagcacgtaca ggccgcaaccctcaaacaggtgcagaaatcaaatcgcagcatctaaagtacctgctttca aagctggtaaagcacttaaagacgctgtaa

DBGET integrated database retrieval system