Candidatus Solibacter usitatus: Acid_1220 Help Entry Acid_1220         CDS       T00412                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism sus  Candidatus Solibacter usitatus Brite KEGG Orthology (KO) [BR:sus00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:sus03036]     Acid_1220 Chromosome and associated proteins [BR:sus03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Acid_1220 SSDB OrthologParalogGFIT Motif Pfam:  ZapB CCDC39 DUF4200 STAT_alpha APG6_N CENP-F_leu_zip CCDC113_CCDC96_CC CC_Bre1 Taxilin FlgN Seryl_tRNA_N GAS Relaxase_C YabA bZIP_1 COG6_N DUF4763 FlaC_arch DUF5320 Cep57_CLD_2 DUF2203 Flagellin_N zf-C4H2 Map3k7cl DUF3450 Muted DUF1664 Mgr1 SPC25_N YxeD Uso1_p115_C PEX14-like_2nd Tho2 Motif Other DBs NCBI-ProteinID:  ABJ82214 UniProt:  Q029R2 LinkDB All DBs Position 1504989..1505231 Genome browser AA seq 80 aa AA seqDB search MSPAEQENDSLSSLEDRIQRAVQMVTVLRQEREAAVQEAAEAKREAALLAEEVKTLQAER KQVRSRIEKLLGQIDQLSAS NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgagccccgccgagcaggaaaacgattccctcagcagtcttgaagatcgcatccagcgc gccgtgcaaatggtgaccgttctccgccaggagcgcgaagccgctgttcaggaggccgcc gaagccaagcgcgaggcggcccttctggccgaagaagtgaaaaccctgcaggccgagcgc aagcaggtgcgcagccgcatcgaaaagctgctgggacagatcgaccaattgagcgcctcc taa

DBGET integrated database retrieval system