Saccharomonospora viridis: Svir_33710 Help Entry Svir_33710        CDS       T00980                                  Name (GenBank) acyl carrier protein   KO K05553   minimal PKS acyl carrier protein Organism svi  Saccharomonospora viridis Pathway svi01056   Biosynthesis of type II polyketide backbone svi01100   Metabolic pathways svi01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:svi00001]  09100 Metabolism   09109 Metabolism of terpenoids and polyketides    01056 Biosynthesis of type II polyketide backbone     Svir_33710    00253 Tetracycline biosynthesis     Svir_33710  09180 Brite Hierarchies   09181 Protein families: metabolism    01004 Lipid biosynthesis proteins [BR:svi01004]     Svir_33710    01008 Polyketide biosynthesis proteins [BR:svi01008]     Svir_33710 Lipid biosynthesis proteins [BR:svi01004]  Polyketide synthase   Component type    Svir_33710 Polyketide biosynthesis proteins [BR:svi01008]  Polyketide synthase (PKS)   Type II PKS    C7-C14 cyclized polyketide type     Octaketide PKS      Svir_33710     Nonaketide PKS      Svir_33710     Decaketide PKS      Svir_33710 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 Ribosomal_L50 Motif Other DBs NCBI-ProteinID:  ACU98335 UniProt:  C7N0D3 LinkDB All DBs Position 3667531..3667800 Genome browser AA seq 89 aa AA seqDB search MTTFGLEDLKRLLTSDSNTGDGSEITESSLTDEFTELGYDSLALLELVSKVEREFGIKLP DDALENMLTPKSTVDYISARIAEKEENRT NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgaccacgttcggccttgaggatctgaaacgtctgctgacgtcggattccaacaccggt gacggttccgagatcaccgagtcgtcgctgaccgacgagttcaccgaactcggctacgac tcgttggcgctgctggagctcgtgagcaaggtggagcgcgagttcgggatcaaactcccc gacgacgcgctcgagaacatgctcacccctaaatccactgtggactacatcagcgcgaga atcgcagagaaggaggagaaccgcacatga

DBGET integrated database retrieval system