Sphingobium sp. YBL2: TZ53_23805 Help Entry TZ53_23805        CDS       T03855                                  Name (GenBank) integration host factor   KO K03530   DNA-binding protein HU-beta Organism syb  Sphingobium sp. YBL2 Brite KEGG Orthology (KO) [BR:syb00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:syb03032]     TZ53_23805    03036 Chromosome and associated proteins [BR:syb03036]     TZ53_23805    03400 DNA repair and recombination proteins [BR:syb03400]     TZ53_23805 DNA replication proteins [BR:syb03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     TZ53_23805 Chromosome and associated proteins [BR:syb03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     TZ53_23805 DNA repair and recombination proteins [BR:syb03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       TZ53_23805 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG Motif Other DBs NCBI-ProteinID:  AJR26855 UniProt:  A0A0C5XQH4 LinkDB All DBs Position 3pYBL2-3:50809..51084 Genome browser AA seq 91 aa AA seqDB search MTNGDLADLLASETGSTKADARKTVDIVFAAIVAASVRGEEVSLGGFGKFKVKELSAREG RNPATGETIKIAASKKLTFSPAKAVKDKLNG NT seq 276 nt NT seq  +upstreamnt  +downstreamnt atgacgaacggtgatcttgcagaccttctcgccagcgaaaccggttccacaaaagccgat gcccgcaagacggtggatatcgtgttcgccgcgatcgtcgcagcctctgtcagaggcgag gaagtgagcctcggcggctttggaaaattcaaggtgaaggagctatccgcccgtgaaggc cgaaatccagcgaccggcgagaccataaaaatcgccgcctcgaagaaacttaccttctct cccgcgaaggcggtcaaagacaaactcaacggctag

DBGET integrated database retrieval system