Thermocrinis albus: Thal_0144 Help Entry Thal_0144         CDS       T01179                                  Name (GenBank) hypothetical protein   KO K02398   negative regulator of flagellin synthesis FlgM Organism tal  Thermocrinis albus Pathway tal02020   Two-component system tal02040   Flagellar assembly Brite KEGG Orthology (KO) [BR:tal00001]  09130 Environmental Information Processing   09132 Signal transduction    02020 Two-component system     Thal_0144  09140 Cellular Processes   09142 Cell motility    02040 Flagellar assembly     Thal_0144  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    02035 Bacterial motility proteins [BR:tal02035]     Thal_0144 Bacterial motility proteins [BR:tal02035]  Flagellar system   Flagellar assembly proteins    Others     Thal_0144 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  FlgM Motif Other DBs NCBI-ProteinID:  ADC88780 UniProt:  D3SNP3 LinkDB All DBs Position complement(134972..135235) Genome browser AA seq 87 aa AA seqDB search MLDKVELARLTQYYLRLEKEREARERKIEDRDGTVRLDISHESVTNPVEEDEISKKAEEI KQKLDSGTYQVSSHKVLEGLEKFFNLY NT seq 264 nt NT seq  +upstreamnt  +downstreamnt atgctggataaggtggagttggcacgtcttacccaatattacctcagactggagaaggaa agggaagcaagggaaaggaagatagaggacagagatggaacggtcaggttagatatatct cacgaaagcgtgaccaatcccgtggaggaggacgagataagcaaaaaggcggaggagata aaacagaagctggacagcggaacctaccaggtgagttctcacaaagttctggaaggtctg gaaaaattcttcaacttgtactga

DBGET integrated database retrieval system