Thermoleophilum album: JDY09_04005 Help Entry JDY09_04005       CDS       T08835                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism talu  Thermoleophilum album Pathway talu01100   Metabolic pathways talu01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:talu00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     JDY09_04005 (acpP)    00074 Mycolic acid biosynthesis     JDY09_04005 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     JDY09_04005 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Ribonuc_red_lgN DUF6894 Ribosomal_L50 Glyco_hydro2_C5 DUF7447 Motif Other DBs NCBI-ProteinID:  WDT94424 LinkDB All DBs Position 866801..867058 Genome browser AA seq 85 aa AA seqDB search MMTRDEILERIREHLAEELELPLERITEDARFREDLDADSLDLVALVVELEDRYGIRIPD EEAAKIETVGQAADYVARHAAALGR NT seq 258 nt NT seq  +upstreamnt  +downstreamnt gtgatgacgcgcgacgagatcctcgagcggatccgcgagcacctcgccgaggagctcgag ctgccgctcgagcggatcaccgaggatgcgcgcttccgcgaggacctcgatgccgactcg ctcgacctggtcgcgctggtcgtcgagctcgaggaccgctacggcatccgcatccccgac gaggaggccgccaagatcgaaacggtcggccaggccgccgactacgtggctcgccatgcc gccgcgctcggccggtga

DBGET integrated database retrieval system