Thermobacillus composti: Theco_2136 Help Entry Theco_2136        CDS       T02394                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism tco  Thermobacillus composti Pathway tco01100   Metabolic pathways tco01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:tco00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     Theco_2136    00074 Mycolic acid biosynthesis     Theco_2136   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     Theco_2136 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 DUF1493 Guanylate_cyc Motif Other DBs NCBI-ProteinID:  AGA58258 UniProt:  L0EDA5 LinkDB All DBs Position complement(2219319..2219552) Genome browser AA seq 77 aa AA seqDB search MSDVFERVKRIVVDRLGVDEAEVTLEASFKEDLGADSLDVVELVMELEDEFDMEISDEDA EKITTVGEVVHYIQSHS NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atgtccgacgtttttgaacgcgtgaagcgtattgtcgtggatcggctgggcgtggacgag gcggaagtgacgctcgaagcgagcttcaaggaagacctcggcgcggattccctggatgtc gtagagcttgtcatggaactggaagacgagttcgatatggaaatatcggacgaagacgcg gagaaaatcaccacggtgggtgaagtcgtccattacatacaatcgcattcttag

DBGET integrated database retrieval system