Thioclava electrotropha: AKL02_009385 Help Entry AKL02_009385      CDS       T06997                                  Name (GenBank) Hsp20 family protein   KO K13993   HSP20 family protein Organism tec  Thioclava electrotropha Brite KEGG Orthology (KO) [BR:tec00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    04141 Protein processing in endoplasmic reticulum     AKL02_009385  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03110 Chaperones and folding catalysts [BR:tec03110]     AKL02_009385 Chaperones and folding catalysts [BR:tec03110]  Heat shock proteins   HSP20    AKL02_009385 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  HSP20 ArsA_HSP20 Motif Other DBs NCBI-ProteinID:  QPZ93166 UniProt:  A0ABX6YZM8 LinkDB All DBs Position complement(1958229..1958480) Genome browser AA seq 83 aa AA seqDB search MELKLEDGRLKIHGERTSEREAHEGDYVLQERSSGRLERMIALPREVDPDRIEAVLSDGV LTVTLPKAAEAREKDRRIDVKAR NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atcgagctcaagctcgaagacgggcggctcaagatccacggcgaacgcaccagcgagcgc gaggcgcatgagggcgactacgtcctgcaggagcggagttccggcaggctcgaacgcatg atcgctctgccgcgcgaggtcgaccccgaccgcatcgaggcggttctgagcgacggggtc ctgaccgtgaccctgccgaaagccgccgaagcgcgcgagaaagatcgccgcatcgacgtc aaggcgcgatga

DBGET integrated database retrieval system