Thioalkalivibrio sulfidiphilus: Tgr7_2767 Help Entry Tgr7_2767         CDS       T00840                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism tgr  Thioalkalivibrio sulfidiphilus Brite KEGG Orthology (KO) [BR:tgr00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:tgr03036]     Tgr7_2767 Chromosome and associated proteins [BR:tgr03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Tgr7_2767 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Phage_Arf ParD_antitoxin YabA TSC22 Motif Other DBs NCBI-ProteinID:  ACL73841 UniProt:  B8GNF0 LinkDB All DBs Position 2908473..2908706 Genome browser AA seq 77 aa AA seqDB search MDTINTQDIAEQELRKLEVRVGELIRTCERLKEENRLLREQQVNLAAERSSLVEGQEAAR LKVEAMIARLKSMEQSA NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggacacgatcaatacacaggacatcgccgaacaggagctcaggaaacttgaggtccgt gtgggtgaactcatccgcacctgcgagcggctcaaagaggaaaaccgcctcctgcgcgag cagcaggtcaacctcgccgccgagcgatcctccctggtggaaggacaggaagcggcgcgt ctgaaggtggaggcgatgatcgcccgcctgaagtccatggagcagtccgcgtga

DBGET integrated database retrieval system