Taeniopygia guttata (zebra finch): 100886595 Help Entry 100886595         miRNA     T01082                                  Symbol MIR26-1 Name (RefSeq) tgu-miR-26-5p   KO K16984   microRNA 26 Organism tgu  Taeniopygia guttata (zebra finch) Brite KEGG Orthology (KO) [BR:tgu00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tgu04147]     100886595 (MIR26-1)   09184 RNA family    03100 Non-coding RNAs [BR:tgu03100]     100886595 (MIR26-1) Exosome [BR:tgu04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100886595 (MIR26-1)   Exosomal RNA of renal carcinoma cells    100886595 (MIR26-1)   Exosomal RNA of other cancer cells    100886595 (MIR26-1) Non-coding RNAs [BR:tgu03100]  Other eukaryotic RNA   Micro RNA    100886595 (MIR26-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100886595 miRBase:  MI0013717 LinkDB All DBs Position 2:4143865..4143936 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt ttcaagtaatccaggataggct

DBGET integrated database retrieval system