Taeniopygia guttata (zebra finch): 100886603 Help Entry 100886603         miRNA     T01082                                  Symbol MIR103-3 Name (RefSeq) tgu-miR-103-3p   KO K16989   microRNA 103 Organism tgu  Taeniopygia guttata (zebra finch) Brite KEGG Orthology (KO) [BR:tgu00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tgu04147]     100886603 (MIR103-3)   09184 RNA family    03100 Non-coding RNAs [BR:tgu03100]     100886603 (MIR103-3) Exosome [BR:tgu04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    100886603 (MIR103-3)   Exosomal RNA of ovarian cancer cells    100886603 (MIR103-3) Non-coding RNAs [BR:tgu03100]  Other eukaryotic RNA   Micro RNA    100886603 (MIR103-3) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100886603 LinkDB All DBs Position 13:complement(5668149..5668171) Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt agcagcattgtacagggctatga

DBGET integrated database retrieval system