Taeniopygia guttata (zebra finch): 100886609 Help Entry 100886609         miRNA     T01082                                  Symbol MIR29A-1 Name (RefSeq) tgu-miR-29a-1-5p   KO K16995   microRNA 29 Organism tgu  Taeniopygia guttata (zebra finch) Brite KEGG Orthology (KO) [BR:tgu00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tgu04147]     100886609 (MIR29A-1)   09184 RNA family    03100 Non-coding RNAs [BR:tgu03100]     100886609 (MIR29A-1) Exosome [BR:tgu04147]  Exosomal RNA   Exosomal RNA of breast milk    100886609 (MIR29A-1)   Exosomal RNA of saliva    100886609 (MIR29A-1)   Exosomal RNA of hepatic cancer cells    100886609 (MIR29A-1)   Exosomal RNA of renal carcinoma cells    100886609 (MIR29A-1)   Exosomal RNA of lung cancer cells    100886609 (MIR29A-1) Non-coding RNAs [BR:tgu03100]  Other eukaryotic RNA   Micro RNA    100886609 (MIR29A-1) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100886609 Ensembl:  ENSTGUG00000017709 miRBase:  MI0013745 LinkDB All DBs Position 1A:3380072..3380142 Genome browser NT seq 23 nt NT seq  +upstreamnt  +downstreamnt actgatttcttttggtgttcaga

DBGET integrated database retrieval system