Entry |
|
Symbol |
MIR16A
|
Name |
|
KO |
|
Organism |
tgu Taeniopygia guttata (zebra finch)
|
Brite |
KEGG Orthology (KO) [BR:tgu00001]
09180 Brite Hierarchies
09183 Protein families: signaling and cellular processes
04147 Exosome [BR:tgu04147]
100886644 (MIR16A)
09184 RNA family
03100 Non-coding RNAs [BR:tgu03100]
100886644 (MIR16A)
Exosome [BR:tgu04147]
Exosomal RNA
Exosomal RNA of breast milk
100886644 (MIR16A)
Exosomal RNA of hepatic cancer cells
100886644 (MIR16A)
Exosomal RNA of lung cancer cells
100886644 (MIR16A)
Exosomal RNA of other cancer cells
100886644 (MIR16A)
Non-coding RNAs [BR:tgu03100]
Other eukaryotic RNA
Micro RNA
100886644 (MIR16A)
|
SSDB |
|
Other DBs |
|
LinkDB |
|
Position |
1:complement(59798504..59798595)
|
NT seq |
22 nt +upstreamnt +downstreamnt
tagcagcacgtaaatattggtg |