Taeniopygia guttata (zebra finch): 100886655 Help Entry 100886655         miRNA     T01082                                  Symbol MIR29B-2 Name (RefSeq) tgu-miR-29b-2-5p   KO K16996   microRNA 29b Organism tgu  Taeniopygia guttata (zebra finch) Brite KEGG Orthology (KO) [BR:tgu00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tgu04147]     100886655 (MIR29B-2)   09184 RNA family    03100 Non-coding RNAs [BR:tgu03100]     100886655 (MIR29B-2) Exosome [BR:tgu04147]  Exosomal RNA   Exosomal RNA of breast milk    100886655 (MIR29B-2)   Exosomal RNA of saliva    100886655 (MIR29B-2) Non-coding RNAs [BR:tgu03100]  Small non-coding RNA   Micro RNA    100886655 (MIR29B-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100886655 Ensembl:  ENSTGUG00000017915 miRBase:  MI0013831 LinkDB All DBs Position 26:1089822..1089892 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tggtttcacatggtggcttaga

DBGET integrated database retrieval system