Taeniopygia guttata (zebra finch): 100886749 Help Entry 100886749         miRNA     T01082                                  Symbol MIR204-2 Name (RefSeq) tgu-miR-204   KO K17166   microRNA 204 Organism tgu  Taeniopygia guttata (zebra finch) Brite KEGG Orthology (KO) [BR:tgu00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tgu04147]     100886749 (MIR204-2)   09184 RNA family    03100 Non-coding RNAs [BR:tgu03100]     100886749 (MIR204-2) Exosome [BR:tgu04147]  Exosomal RNA   Exosomal RNA of hepatic cancer cells    100886749 (MIR204-2) Non-coding RNAs [BR:tgu03100]  Other eukaryotic RNA   Micro RNA    100886749 (MIR204-2) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Other DBs NCBI-GeneID:  100886749 miRBase:  MI0013792 LinkDB All DBs Position 10:5346127..5346198 Genome browser NT seq 22 nt NT seq  +upstreamnt  +downstreamnt ttccctttgtcatcctatgcct

DBGET integrated database retrieval system