Thermomonas sp. XSG: ICG51_002121 Help Entry ICG51_002121      CDS       T10183                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism thex  Thermomonas sp. XSG Brite KEGG Orthology (KO) [BR:thex00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:thex03032]     ICG51_002121    03036 Chromosome and associated proteins [BR:thex03036]     ICG51_002121    03400 DNA repair and recombination proteins [BR:thex03400]     ICG51_002121 DNA replication proteins [BR:thex03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     ICG51_002121 Chromosome and associated proteins [BR:thex03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     ICG51_002121 DNA repair and recombination proteins [BR:thex03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       ICG51_002121 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_2 HU-DNA_bdg DUF2267 HU-CCDC81_euk_1 Phage_cement_2 Chalcone_3 Peptidase_M35 Motif Other DBs NCBI-ProteinID:  QNU15730 UniProt:  A0A7H1RN91 LinkDB All DBs Position 2246867..2247139 Genome browser AA seq 90 aa AA seqDB search MNKAEFVEAVADNAELTKADAGRAVDAMVAAITKALKKGDTVTLVGFGTFSVRKRGARTG RNPRTGDTIKIKASKNPAFKAGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt atgaacaaagccgaattcgtcgaagccgtcgccgacaatgccgaactgaccaaggccgat gccggtcgcgctgttgatgcgatggtcgccgccatcaccaaggccctcaagaagggcgac accgtgaccctcgtgggcttcggcaccttctcggtccgcaagcgcggcgcccgcaccggc cgcaacccgcgcaccggcgacaccatcaagatcaaggcctccaagaacccggcgttcaag gccggcaaggcgctgaaggacgcggtcaactga

DBGET integrated database retrieval system