Thermoanaerobacter sp. RKWS2: OEI98_001368 Help Entry OEI98_001368      CDS       T10300                                  Symbol hfq Name (GenBank) RNA chaperone Hfq   KO K03666   host factor-I protein Organism thez  Thermoanaerobacter sp. RKWS2 Pathway thez02024   Quorum sensing thez03018   RNA degradation Brite KEGG Orthology (KO) [BR:thez00001]  09120 Genetic Information Processing   09123 Folding, sorting and degradation    03018 RNA degradation     OEI98_001368 (hfq)  09140 Cellular Processes   09145 Cellular community - prokaryotes    02024 Quorum sensing     OEI98_001368 (hfq)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03019 Messenger RNA biogenesis [BR:thez03019]     OEI98_001368 (hfq)    03036 Chromosome and associated proteins [BR:thez03036]     OEI98_001368 (hfq) Messenger RNA biogenesis [BR:thez03019]  Prokaryotic type   Bacterial mRNA degradation factors    Other RNA degradation factors     Chaperones      OEI98_001368 (hfq) Chromosome and associated proteins [BR:thez03036]  Prokaryotic type   Nucleoid associated proteins    Other nucleoid associated proteins     OEI98_001368 (hfq) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Hfq Hfq_1 LSM Motif Other DBs NCBI-ProteinID:  UZQ84170 LinkDB All DBs Position 1322990..1323250 Genome browser AA seq 86 aa AA seqDB search MASSKAAINLQDIFLNQVRKEHVPVTVYLINGFQLKGLVKGFDNFTVVLESENKQQLLIY KHAISTITPQKPVIFSASDKDEKKEE NT seq 261 nt NT seq  +upstreamnt  +downstreamnt atggcaagttcaaaagcagctattaatttacaggatatctttttaaatcaagtgagaaaa gagcatgtaccagtaactgtctacttaatcaatggattccaattaaagggtttagtgaaa ggatttgataattttacggtggtgttggagtcagagaacaaacagcaacttcttatctac aagcatgctatttcgacaattacaccccaaaagcctgtaatcttctctgcttctgataag gatgagaagaaagaagagtaa

DBGET integrated database retrieval system