KEGG   Thermogladius calderae: TCELL_0353
Entry
TCELL_0353        CDS       T02127                                 
Name
(GenBank) DKCLD domain protein
  KO
K03177  tRNA pseudouridine55 synthase [EC:5.4.99.25]
Organism
thg  Thermogladius calderae
Brite
KEGG Orthology (KO) [BR:thg00001]
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03016 Transfer RNA biogenesis [BR:thg03016]
    TCELL_0353
Enzymes [BR:thg01000]
 5. Isomerases
  5.4  Intramolecular transferases
   5.4.99  Transferring other groups
    5.4.99.25  tRNA pseudouridine55 synthase
     TCELL_0353
Transfer RNA biogenesis [BR:thg03016]
 Eukaryotic type
  tRNA modification factors
   Psudouridine synthases
    TCELL_0353
 Prokaryotic type
    TCELL_0353
SSDB
Motif
Pfam: DKCLD TruB_N
Other DBs
NCBI-ProteinID: AFK50778
UniProt: I3TDE0
LinkDB
Position
328571..328840
AA seq 89 aa
MGLVERGLEFLDHITERAGYKNDWIVVREADTSSDYGRLPYERPIKEHIVNGVINLDKPP
GPTSHEVVAWVKKLVGVSKAGHGGTLEPL
NT seq 270 nt   +upstreamnt  +downstreamnt
atgggtctagtagagagagggctggaattcctagaccacataacggagagagccggctac
aaaaacgactggatagtagtgagagaagccgacacgtcgagcgattacggtagacttccc
tacgagaggccgatcaaggagcacatagtcaacggagtgataaacttagacaaaccacca
gggcctacaagccacgaagtagtagcatgggttaaaaaactggtaggggttagcaaggca
ggacacgggggtaccctagagcccctgtag

DBGET integrated database retrieval system