Thermotoga sp. RQ7: TRQ7_04085 Help Entry TRQ7_04085        CDS       T03669                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism thr  Thermotoga sp. RQ7 Pathway thr01100   Metabolic pathways thr01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:thr00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     TRQ7_04085   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     TRQ7_04085 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding FAM180 DASH_Dad2 PP-binding_2 Motif Other DBs NCBI-ProteinID:  AJG40634 UniProt:  A0A0B5KPU7 LinkDB All DBs Position complement(788810..789079) Genome browser AA seq 89 aa AA seqDB search MEREKLLAKFVEIVSEKMGKNLETIDEDVSFGELGFDSLDVIDLVMFFEDEFAIRIEDEE LESLRRVKDLIDIVSRKLEEVNDEVSEGG NT seq 270 nt NT seq  +upstreamnt  +downstreamnt ttggaaagagaaaagcttcttgcaaagtttgtggaaatagtttcagagaagatgggaaag aatctggagacgatcgatgaagatgtctcttttggagaactcggctttgattcgctagat gtgatagatcttgtcatgttcttcgaagacgagttcgcaataaggatagaggacgaagag ctcgaaagtcttcgcagggtaaaagatctgatagatatcgtgagcagaaaactggaggag gtcaacgatgaggtatctgagggcggatga

DBGET integrated database retrieval system