Thermotomaculum hydrothermale: TTHT_0948 Help Entry TTHT_0948         CDS       T06993                                  Name (GenBank) DNA-binding protein HU-beta   KO K03530   DNA-binding protein HU-beta Organism thyd  Thermotomaculum hydrothermale Brite KEGG Orthology (KO) [BR:thyd00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:thyd03032]     TTHT_0948    03036 Chromosome and associated proteins [BR:thyd03036]     TTHT_0948    03400 DNA repair and recombination proteins [BR:thyd03400]     TTHT_0948 DNA replication proteins [BR:thyd03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     TTHT_0948 Chromosome and associated proteins [BR:thyd03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     TTHT_0948 DNA repair and recombination proteins [BR:thyd03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       TTHT_0948 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 SeleniumBinding HU-CCDC81_euk_2 Urease_beta MvaT_DBD Terminase_6N Motif Other DBs NCBI-ProteinID:  BBB32502 UniProt:  A0A7R6PTR2 LinkDB All DBs Position complement(998304..998570) Genome browser AA seq 88 aa AA seqDB search MVKNDIVKKIVESTGISTAEANEAVNIMISSIKDAILKGERVEFRGFGIFYLRNKKLGVG RNPKTGEVIKIKEGKSIKFKPGKQLKNI NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atggttaagaatgatattgtaaaaaagattgtagaatcaaccggtatttctacagctgag gcaaatgaggctgtaaacatcatgatttcttctattaaagatgcaattttgaagggagaa agggtagagtttagagggtttggcattttttatttaagaaacaaaaagttaggggttggt agaaatcctaaaacaggcgaagtgattaaaattaaagaaggcaaatcaatcaagttcaaa ccaggtaaacaattaaaaaatatttaa

DBGET integrated database retrieval system