Thiomonas intermedia: Tint_1431 Help Entry Tint_1431         CDS       T01227                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism tin  Thiomonas intermedia Brite KEGG Orthology (KO) [BR:tin00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:tin03036]     Tint_1431 Chromosome and associated proteins [BR:tin03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Tint_1431 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB DUF3450 CENPH ATG16 TMF_DNA_bd Tropomyosin GAS Cortex-I_coil Cep57_CLD_2 Spectrin YabA Taxilin KIF21A bZIP_1 Asd-4 UPF0242 ODAD1_CC TetR_C_24 Prefoldin PAH PutA_1st H-kinase_dim INO80F Motif Other DBs NCBI-ProteinID:  ADG30815 UniProt:  D5X119 LinkDB All DBs Position complement(1538805..1539056) Genome browser AA seq 83 aa AA seqDB search MPRMDERQPSPAIAQLQSRVERLLLRHNELLRTNALLAERVQSLEAERDQMRQRLHDATQ RIDRLLARLDQTPSISGEPDPHA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgcctcgcatggacgaacgacagccctcccccgccatcgctcagttgcaatcgcgcgtt gagcggctgctgctgcgtcacaacgagttgctgcgcaccaacgccttactggccgagcgg gtgcaatcgctcgaagccgagcgcgaccagatgcgtcagcgcctgcacgacgccacccag cgcatcgaccgattgctggcacggctggatcagaccccttccatttcgggcgagcccgac ccacacgcatga

DBGET integrated database retrieval system