Thermotoga maritima MSB8: TM0175 Help Entry TM0175            CDS       T00022                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism tma  Thermotoga maritima MSB8 Pathway tma01100   Metabolic pathways tma01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:tma00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     TM0175    00074 Mycolic acid biosynthesis     TM0175   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     TM0175 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  PP-binding ACP_SdgA_C FAM180 PP-binding_2 Motif Other DBs NCBI-ProteinID:  AAD35268 UniProt:  Q9WY19 Structure PDBPDBj LinkDB All DBs Position 184520..184786 Genome browser AA seq 88 aa AA seqDB search MERKKLIAKFVEIASEKMGKDLETVDEENTFKELGFDSIDVIDLVMFFEDEFALRIEDEE ISKIRKVKDLIDIVIKKLEEIDDEVSEG NT seq 267 nt NT seq  +upstreamnt  +downstreamnt gtggaaagaaaaaagctcattgcgaaatttgtcgaaatcgcgtcagagaaaatgggaaaa gatcttgaaacggttgatgaggaaaacacgttcaaagagctcggattcgattcgatagac gtgatagatcttgtgatgttcttcgaggatgaatttgccttgagaatagaagatgaggaa atatcgaaaatccggaaggttaaggatttgatcgatatcgtaatcaagaagctggaggag atcgacgatgaggtatctgagggctga

DBGET integrated database retrieval system