Tuber melanosporum: GSTUM_00010175001 Help Entry GSTUM_00010175001 CDS       T01282                                  Name (RefSeq) hypothetical protein   KO K11368   enhancer of yellow 2 transcription factor Organism tml  Tuber melanosporum Brite KEGG Orthology (KO) [BR:tml00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03021 Transcription machinery [BR:tml03021]     GSTUM_00010175001    03019 Messenger RNA biogenesis [BR:tml03019]     GSTUM_00010175001    03036 Chromosome and associated proteins [BR:tml03036]     GSTUM_00010175001 Transcription machinery [BR:tml03021]  Eukaryotic type   RNA polymerase II system    Coactivators     SAGA/TFTC/STAGA complex      GSTUM_00010175001 Messenger RNA biogenesis [BR:tml03019]  Eukaryotic type   mRNA surveillance and transport factors    Transport factors     TREX-2 complex      GSTUM_00010175001 Chromosome and associated proteins [BR:tml03036]  Eukaryotic type   Histone modification proteins    HAT complexes     SAGA complex      GSTUM_00010175001 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  EnY2 Motif Other DBs NCBI-GeneID:  9186095 NCBI-ProteinID:  XP_002841160 INRA:  GSTUM_00010175001 UniProt:  D5GLF8 LinkDB All DBs AA seq 94 aa AA seqDB search MSQDTTLRAEVNRRLLESGELERLEALFLDLLRESGWYENTRNTCAEKLRSGELAGGGFN RLTEEVERECREKVPEEIYQVKAIKKVLEGMVEG NT seq 285 nt NT seq  +upstreamnt  +downstreamnt atgtcccaggacactaccttacgcgcggaggtgaaccgccgccttctagaatccggggag cttgaacgcctagaagcgctcttcctggacctcctgagggagtccggctggtacgagaac acgaggaatacgtgcgcggagaagctgcgcagcggggaattggccggcggcggattcaat cgacttacggaggaggtggaacgggagtgtcgggagaaggtgcccgaggagatctaccag gttaaggctatcaagaaggttttggaggggatggttgagggatga

DBGET integrated database retrieval system