Thermotoga maritima MSB8: THMA_0171 Help Entry THMA_0171         CDS       T03902                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism tmw  Thermotoga maritima MSB8 Pathway tmw01100   Metabolic pathways tmw01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:tmw00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     THMA_0171    00074 Mycolic acid biosynthesis     THMA_0171   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     THMA_0171 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding ACP_SdgA_C FAM180 PP-binding_2 Motif Other DBs NCBI-ProteinID:  AKE27980 UniProt:  Q9WY19 Structure PDBPDBj LinkDB All DBs Position 184520..184786 Genome browser AA seq 88 aa AA seqDB search MERKKLIAKFVEIASEKMGKDLETVDEENTFKELGFDSIDVIDLVMFFEDEFALRIEDEE ISKIRKVKDLIDIVIKKLEEIDDEVSEG NT seq 267 nt NT seq  +upstreamnt  +downstreamnt gtggaaagaaaaaagctcattgcgaaatttgtcgaaatcgcgtcagagaaaatgggaaaa gatcttgaaacggttgatgaggaaaacacgttcaaagagctcggattcgattcgatagac gtgatagatcttgtgatgttcttcgaggatgaatttgccttgagaatagaagatgaggaa atatcgaaaatccggaaggttaaggatttgatcgatatcgtaatcaagaagctggaggag atcgacgatgaggtatctgagggctga

DBGET integrated database retrieval system