Triplophysa rosa: 14048443 Help Entry 14048443          CDS       T09216                                  Symbol ND4L, F747_mgp05 Name (RefSeq) NADH dehydrogenase subunit 4L   KO K03882   NADH-ubiquinone oxidoreductase chain 4L [EC:7.1.1.2] Organism tros  Triplophysa rosa Pathway tros00190   Oxidative phosphorylation tros01100   Metabolic pathways Module tros_M00142   NADH:ubiquinone oxidoreductase, mitochondria Brite KEGG Orthology (KO) [BR:tros00001]  09100 Metabolism   09102 Energy metabolism    00190 Oxidative phosphorylation     14048443 (ND4L)  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03029 Mitochondrial biogenesis [BR:tros03029]     14048443 (ND4L) Enzymes [BR:tros01000]  7. Translocases   7.1  Catalysing the translocation of protons    7.1.1  Linked to oxidoreductase reactions     7.1.1.2  NADH:ubiquinone reductase (H+-translocating)      14048443 (ND4L) Mitochondrial biogenesis [BR:tros03029]  Mitochondrial DNA transcription, translation, and replication factors   Mitochondrial DNA-encoded proteins    Mitochondrial respiratory chain complex I     14048443 (ND4L) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Oxidored_q2 Motif Other DBs NCBI-GeneID:  14048443 NCBI-ProteinID:  YP_007025003 UniProt:  K4EI98 LinkDB All DBs Position MT:10074..10370 Genome browser AA seq 98 aa AA seqDB search MTPVHFSFSSAFMLGLMGLAFHRTHLLSALLCLEGMMLSLFIALALWTMQLESTMFSAAP MLLLAFSACEASAGLALLVATARTHGTDRLQNLSLLQC NT seq 297 nt NT seq  +upstreamnt  +downstreamnt atgacacccgtacacttcagctttagttcagcttttatactaggtcttataggtctagca tttcatcgcacccatttgctctctgcgctgctttgcctggaaggaataatattatcctta ttcattgcactagccctctgaaccatgcaacttgaatcaaccatattttctgcagcccca atactattactagccttctctgcctgcgaggccagcgcaggtttagccctattggttgcc actgcccgaacccatggaaccgatcgactacaaaacctaagtctactacaatgttaa

DBGET integrated database retrieval system