Thiobacillus sedimenti: VA613_14435 Help Entry VA613_14435       CDS       T10461                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism tsw  Thiobacillus sedimenti Brite KEGG Orthology (KO) [BR:tsw00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:tsw03036]     VA613_14435 Chromosome and associated proteins [BR:tsw03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     VA613_14435 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  ZapB_rel ZapB CC_Bre1 YabA HAP1_N UPF0242 SPC25_N DUF4515 GAS Rab11-FIP3 FKBP15 Cep57_CLD_2 ADIP CEP135_TSGA10_CC Rootletin ACBP4_C Csm1_N TSC22 LEKR1 DUF6584 DUF8429 BNI5_helical SlyX MTUS1_CCDC69_CC2 CCDC138_cc Motif Other DBs NCBI-ProteinID:  WRS39188 UniProt:  A0ABZ1CJJ0 LinkDB All DBs Position 2908849..2909046 Genome browser AA seq 65 aa AA seqDB search MHAELDSLEAKIRQVAELCHALRRENIALRQQLLAAQQDNKQLNTRLEAARNRLQGLLDT LPEDV NT seq 198 nt NT seq  +upstreamnt  +downstreamnt atgcacgccgaactcgattccctcgaagcgaagatccgccaggtggccgagctgtgccat gcgctgcggcgcgagaacatcgcgctgcgccagcagctgcttgccgcgcagcaggacaac aagcagctgaacacccgcctggaagcggcccgaaaccggctgcagggcctgctcgacacc cttccggaggacgtctga

DBGET integrated database retrieval system