Tupaia chinensis (Chinese tree shrew): 104795981 Help Entry 104795981         miRNA     T02978                                  Symbol MIR17, tch-mir-17 Name (RefSeq) microRNA 17   KO K17002   microRNA 17 Organism tup  Tupaia chinensis (Chinese tree shrew) Pathway tup05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:tup00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104795981 (MIR17)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tup04147]     104795981 (MIR17)   09184 RNA family    03100 Non-coding RNAs [BR:tup03100]     104795981 (MIR17) Exosome [BR:tup04147]  Exosomal RNA   Exosomal RNA of haemopoietic cells    104795981 (MIR17)   Exosomal RNA of breast milk    104795981 (MIR17)   Exosomal RNA of saliva    104795981 (MIR17)   Exosomal RNA of breast cancer cells    104795981 (MIR17)   Exosomal RNA of colorectal cancer cells    104795981 (MIR17)   Exosomal RNA of lung cancer cells    104795981 (MIR17) Non-coding RNAs [BR:tup03100]  Other eukaryotic RNA   Micro RNA    104795981 (MIR17) BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  104795981 miRBase:  MI0031174 LinkDB All DBs Position Un NT seq 23 nt NT seq  +upstreamnt  +downstreamnt caaagtgcttacagtgcaggtag

DBGET integrated database retrieval system