Tupaia chinensis (Chinese tree shrew): 104796035 Help Entry 104796035         miRNA     T02978                                  Symbol MIR21, tch-mir-21 Name (RefSeq) microRNA 21   KO K16863   microRNA 21 Organism tup  Tupaia chinensis (Chinese tree shrew) Pathway tup05205   Proteoglycans in cancer tup05206   MicroRNAs in cancer Brite KEGG Orthology (KO) [BR:tup00001]  09160 Human Diseases   09161 Cancer: overview    05206 MicroRNAs in cancer     104796035 (MIR21)    05205 Proteoglycans in cancer     104796035 (MIR21)  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tup04147]     104796035 (MIR21)   09184 RNA family    03100 Non-coding RNAs [BR:tup03100]     104796035 (MIR21) Exosome [BR:tup04147]  Exosomal RNA   Exosomal RNA of breast milk    104796035 (MIR21)   Exosomal RNA of ovarian cancer cells    104796035 (MIR21)   Exosomal RNA of lung cancer cells    104796035 (MIR21)   Exosomal RNA of other cancer cells    104796035 (MIR21) Non-coding RNAs [BR:tup03100]  Other eukaryotic RNA   Micro RNA    104796035 (MIR21) BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  104796035 miRBase:  MI0031258 LinkDB All DBs Position Un NT seq 22 nt NT seq  +upstreamnt  +downstreamnt tagcttatcagactgatgttga

DBGET integrated database retrieval system