Tupaia chinensis (Chinese tree shrew): 104796056 Help Entry 104796056         miRNA     T02978                                  Symbol MIR93, tch-mir-93 Name (RefSeq) microRNA 93   KO K17037   microRNA 93 Organism tup  Tupaia chinensis (Chinese tree shrew) Brite KEGG Orthology (KO) [BR:tup00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tup04147]     104796056 (MIR93)   09184 RNA family    03100 Non-coding RNAs [BR:tup03100]     104796056 (MIR93) Exosome [BR:tup04147]  Exosomal RNA   Exosomal RNA of breast milk    104796056 (MIR93)   Exosomal RNA of other cancer cells    104796056 (MIR93) Non-coding RNAs [BR:tup03100]  Other eukaryotic RNA   Micro RNA    104796056 (MIR93) BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  104796056 miRBase:  MI0031290 LinkDB All DBs Position Un NT seq 23 nt NT seq  +upstreamnt  +downstreamnt caaagtgctgttcgtgcaggtag

DBGET integrated database retrieval system