Tupaia chinensis (Chinese tree shrew): 104796601 Help Entry 104796601         miRNA     T02978                                  Symbol MIR147B, tch-mir-147b Name (RefSeq) microRNA 147b   KO K17146   microRNA 147 Organism tup  Tupaia chinensis (Chinese tree shrew) Brite KEGG Orthology (KO) [BR:tup00001]  09180 Brite Hierarchies   09183 Protein families: signaling and cellular processes    04147 Exosome [BR:tup04147]     104796601 (MIR147B)   09184 RNA family    03100 Non-coding RNAs [BR:tup03100]     104796601 (MIR147B) Exosome [BR:tup04147]  Exosomal RNA   Exosomal RNA of ovarian cancer cells    104796601 (MIR147B) Non-coding RNAs [BR:tup03100]  Other eukaryotic RNA   Micro RNA    104796601 (MIR147B) BRITE hierarchy SSDB OrthologParalogGFIT Other DBs NCBI-GeneID:  104796601 miRBase:  MI0031170 LinkDB All DBs Position Un NT seq 21 nt NT seq  +upstreamnt  +downstreamnt gtgtgcggaaatgcttctgct

DBGET integrated database retrieval system