Undibacterium parvum: EJN92_16340 Help Entry EJN92_16340       CDS       T05754                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism upv  Undibacterium parvum Brite KEGG Orthology (KO) [BR:upv00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:upv03032]     EJN92_16340    03036 Chromosome and associated proteins [BR:upv03036]     EJN92_16340    03400 DNA repair and recombination proteins [BR:upv03400]     EJN92_16340 DNA replication proteins [BR:upv03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     EJN92_16340 Chromosome and associated proteins [BR:upv03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     EJN92_16340 DNA repair and recombination proteins [BR:upv03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       EJN92_16340 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Bac_DNA_binding HU-HIG HU-CCDC81_bac_2 HU-CCDC81_euk_1 Phage_cement_2 Motif Other DBs NCBI-ProteinID:  AZP13418 UniProt:  A0A3S9HMV1 LinkDB All DBs Position 3740843..3741115 Genome browser AA seq 90 aa AA seqDB search MNKTELIDHIAKTADISKAASARALDALIGAVKVTLKKGNTVTLVGFGTFSVGKRAARTG RNPRTGEAIKIKAAKVPKFKPGKALKDAVN NT seq 273 nt NT seq  +upstreamnt  +downstreamnt gtgaataaaacagaattaatcgatcatattgcgaaaacagccgacatttctaaggctgcg tcagcgcgcgctttggatgctttgatcggtgcagtaaaagtaactttgaaaaaaggtaac acggtaactctggttggattcgggaccttctccgtcggcaagcgtgccgctagaactggt cgtaatccacgtaccggtgaagcaattaaaatcaaagcagccaaggttcctaaatttaaa cctggcaaagctttgaaagatgctgtaaactaa

DBGET integrated database retrieval system