Variovorax paradoxus S110: Vapar_2546 Help Entry Vapar_2546        CDS       T00916                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism vap  Variovorax paradoxus S110 Brite KEGG Orthology (KO) [BR:vap00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vap03036]     Vapar_2546 Chromosome and associated proteins [BR:vap03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     Vapar_2546 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Crescentin Taxilin Uds1 DUF4407 DUF4164 Rootletin DivIVA Cep57_CLD_2 CCDC106 Spectrin Xre_MbcA_ParS-like_N DivIC Muted TolA_bind_tri COG3_N DUF4140 Phage_GPO DUF5320 Motif Other DBs NCBI-ProteinID:  ACS19172 UniProt:  C5CKL8 LinkDB All DBs Position 1:complement(2687999..2688223) Genome browser AA seq 74 aa AA seqDB search MPASSPIDQIAERVERLLVRHEEVQRTNALLQEQVEALTRERDALKSRLAAARTRLDALL ERLPAEPPSQDSPA NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atgcccgcctccagccccatcgaccagatcgccgagcgtgtggaacgcctgctcgtgcgt catgaagaggtgcagcgcaccaatgcgctgctgcaggagcaggtcgaagcgctcacgcgc gagcgcgacgcgttgaagtcgcggctggccgcggcccgcacgcgcctcgatgcgctgctc gagcggctgccggccgaaccaccttcccaagattcccccgcatga

DBGET integrated database retrieval system