Vibrio cholerae O1 LMA3984-4: VCLMA_A2377 Help Entry VCLMA_A2377       CDS       T01871                                  Name (GenBank) Putative cytoplasmic protein   KO K09892   cell division protein ZapB Organism vcl  Vibrio cholerae O1 LMA3984-4 Brite KEGG Orthology (KO) [BR:vcl00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vcl03036]     VCLMA_A2377 Chromosome and associated proteins [BR:vcl03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     VCLMA_A2377 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB YabA Nuf2_DHR10-like Dynamin-like_hel_bact DUF7491 DUF3450 GAS betaPIX_CC APG6_N Dor1 T7SS_ESX_EspC ERM_helical HALZ COG3_N Syntaxin PspA_IM30 Spc7 CCDC113_CCDC96_CC Ax_dynein_light HAUS-augmin3 NUDE_C Prefoldin UPF0242 DUF2203 ToxN_toxin THOC7 TMF_TATA_bd Muted DUF4337 JIP_LZII LCD1 Mis12 DLIC ATG16 CsiV ADIP V_ATPase_I Herpes_UL6 DivIC DUF2205 DUF4407 DUF1664 Prefoldin_2 Occludin_ELL Prominin FapA NPV_P10 bZIP_1 Sipho_Gp157 TMPIT MCU DUF724 AAA_13 MG280 OmpH Sos7 Rx_N YlqD Phage_GPO BRE1 TFR_dimer XRCC4_CC PCRF HAUS6_N EMC3_TMCO1 ATG14 CENP-Q DNA_topoisoIV CLZ 5_nucleotid Fib_alpha Motif Other DBs NCBI-ProteinID:  AEA79566 LinkDB All DBs Position I:complement(2685779..2686021) Genome browser AA seq 80 aa AA seqDB search MSFEVLEKLEAKIQTAVDTIALLQMEVEELKEEKQQLQNEAQELREAREALEQRAQQVQQ EHAAWQERIRSLLGKMEDVE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcttttgaagtattagaaaaactggaagcgaaaattcaaactgcagtcgacaccatt gcactgctgcaaatggaagttgaagagctcaaagaagaaaagcaacagctgcaaaatgaa gcgcaagagctgcgtgaagcgcgtgaagcacttgagcaacgtgcacagcaagttcagcaa gagcatgcggcatggcaagagcgtattcgtagcctgctgggcaaaatggaagacgtggaa taa

DBGET integrated database retrieval system