Volvox carteri f. nagariensis: VOLCADRAFT_47527 Help Entry VOLCADRAFT_47527  CDS       T01330                                  Name (RefSeq) hypothetical protein   KO K03126   transcription initiation factor TFIID subunit 12 Organism vcn  Volvox carteri f. nagariensis Pathway vcn03022   Basal transcription factors Brite KEGG Orthology (KO) [BR:vcn00001]  09120 Genetic Information Processing   09121 Transcription    03022 Basal transcription factors     VOLCADRAFT_47527  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03021 Transcription machinery [BR:vcn03021]     VOLCADRAFT_47527    03036 Chromosome and associated proteins [BR:vcn03036]     VOLCADRAFT_47527 Transcription machinery [BR:vcn03021]  Eukaryotic type   RNA polymerase II system    Basal transcription factors     TFIID      VOLCADRAFT_47527    Coactivators     SAGA/TFTC/STAGA complex      VOLCADRAFT_47527 Chromosome and associated proteins [BR:vcn03036]  Eukaryotic type   Histone modification proteins    HAT complexes     PCAF complex      VOLCADRAFT_47527     STAGA complex      VOLCADRAFT_47527     TFTC complex      VOLCADRAFT_47527     SAGA complex      VOLCADRAFT_47527     SLIK complex      VOLCADRAFT_47527 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  TFIID_20kDa Motif Other DBs NCBI-GeneID:  9620381 NCBI-ProteinID:  XP_002947555 JGI:  47527 UniProt:  D8TM96 LinkDB All DBs Position Unknown AA seq 89 aa AA seqDB search MDRDYVVDPATESALLEFYTEWIGNAVALGCEVAKRRKSNILKARDIALHLERSWNLYVP GFNGEMLKPYRRPHASELHRQRQLAVRRT NT seq 267 nt NT seq  +upstreamnt  +downstreamnt atggatcgtgactacgtggtcgatccagctactgaatcggcgctgttggagttctacacg gagtggatcggcaacgcggtggctctgggctgcgaggtggccaagcgacgcaagtcgaat atcctcaaggctcgcgacatcgcgctgcacctggagcgttcctggaatctgtatgtccct ggcttcaacggggaaatgctgaagccgtaccgccggccgcacgcatcggaattgcaccgg caacggcagttggcggtgcggcgaacg

DBGET integrated database retrieval system