Vibrio coralliilyticus OCN014: JV59_25575 Help Entry JV59_25575        CDS       T03497                                  Name (GenBank) hypothetical protein   KO K03746   DNA-binding protein H-NS Organism vct  Vibrio coralliilyticus OCN014 Brite KEGG Orthology (KO) [BR:vct00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vct03036]     JV59_25575    03400 DNA repair and recombination proteins [BR:vct03400]     JV59_25575 Chromosome and associated proteins [BR:vct03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     JV59_25575 DNA repair and recombination proteins [BR:vct03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       JV59_25575 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS_N Motif Other DBs NCBI-ProteinID:  AIS58382 LinkDB All DBs Position pOCN014:complement(300830..301069) Genome browser AA seq 79 aa AA seqDB search MSNQLATLRHVRRLRACLRSLSLEELEVALSNLQTVVQEHRTREREAALASIVERIRCSG LSVDEILTGLKALASRSAE NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgtcgaatcagttggcgacattacggcacgtacgtcgtttgcgagcgtgtcttcgctcg ctatcacttgaagaattggaggtggcattgagcaatcttcagacggtggtgcaagagcac cgcacgcgcgagcgagaagcggcgctggcgtcgattgttgaacgcatcaggtgcagcgga ttgagtgttgatgagatcctcacggggctgaaagcgttggcgtcccgctcggctgagtag

DBGET integrated database retrieval system