Vibrio coralliilyticus RE98: IX92_28490 Help Entry IX92_28490        CDS       T03444                                  Name (GenBank) hypothetical protein   KO K03746   DNA-binding protein H-NS Organism vcy  Vibrio coralliilyticus RE98 Brite KEGG Orthology (KO) [BR:vcy00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vcy03036]     IX92_28490    03400 DNA repair and recombination proteins [BR:vcy03400]     IX92_28490 Chromosome and associated proteins [BR:vcy03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     IX92_28490 DNA repair and recombination proteins [BR:vcy03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       IX92_28490 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS_N Motif Other DBs NCBI-ProteinID:  AIW22961 UniProt:  A0AAN0SKS0 LinkDB All DBs Position p319:complement(300252..300491) Genome browser AA seq 79 aa AA seqDB search MSNQLATLRHVRRLRACLRSLSLEELEVALSNLQTVVQEHRTREREAALASIVERIRCSG LSVDEILTGLKALAPHSAE NT seq 240 nt NT seq  +upstreamnt  +downstreamnt atgtcgaatcagttggcgacattacggcacgtacgtcgtttgcgagcgtgtcttcgctcg ctatcacttgaagagctggaggtggcattgagcaatcttcagacggtggtgcaagagcac cgcacgcgcgagcgagaagcggcgttggcgtcgattgttgaacgcatcaggtgcagcgga ttgagtgttgatgagatcctcacggggctgaaagcgttagcgccccactcggctgagtag

DBGET integrated database retrieval system