Verrucosispora sp. TAA-831: ACQVFL_05960 Help Entry ACQVFL_05960      CDS       T11182                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism vet  Verrucosispora sp. TAA-831 Pathway vet00998   Biosynthesis of various antibiotics vet01100   Metabolic pathways vet01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:vet00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ACQVFL_05960    00074 Mycolic acid biosynthesis     ACQVFL_05960   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ACQVFL_05960 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7736 Motif Other DBs NCBI-ProteinID:  XUR91836 LinkDB All DBs Position 1306339..1306590 Genome browser AA seq 83 aa AA seqDB search MSTHALGWQTVARQILAEISGRAVETIIISTRLSDLGLDSLGRLTLAVLLEERTGRPLPD DELISVRTLDDLERLLRPTERSA NT seq 252 nt NT seq  +upstreamnt  +downstreamnt atgagcacgcatgctctgggctggcagaccgtagcccggcagatccttgccgagatcagc ggccgggccgtcgagaccatcatcatctccacccggctgtccgatctcggtctggactcg ctcggccggctcacgctcgcggtgctactggaggaacgaaccggccgtccgttgcccgac gacgagctgatcagcgtcaggacgctggacgatcttgagcggctgctgagacccacggag cgttcggcatga

DBGET integrated database retrieval system