Vitreoscilla filiformis: VITFI_CDS1868 Help Entry VITFI_CDS1868     CDS       T04960                                  Name (GenBank) hypothetical protein   KO K03746   DNA-binding protein H-NS Organism vff  Vitreoscilla filiformis Brite KEGG Orthology (KO) [BR:vff00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vff03036]     VITFI_CDS1868    03400 DNA repair and recombination proteins [BR:vff03400]     VITFI_CDS1868 Chromosome and associated proteins [BR:vff03036]  Prokaryotic type   Nucleoid associated proteins    HNS (histone-like nucleoid structuring protein)     VITFI_CDS1868 DNA repair and recombination proteins [BR:vff03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHDIR (short-homology-dependent illegitimate recombination)      Supressor       VITFI_CDS1868 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  Histone_HNS Motif Other DBs NCBI-ProteinID:  ASM77646 UniProt:  A0A221KF59 LinkDB All DBs Position complement(1949177..1949416) Genome browser AA seq 79 aa AA seqDB search MVARITALMEFWHISLDEIARTPTPVRPAAPRVIKYRHPVSGETWDGQGQHPEWLRQALL KEGWRVDELKPANQNSTEH NT seq 240 nt NT seq  +upstreamnt  +downstreamnt gtggtcgcccgcatcacggccctgatggagttctggcacatttcgctggacgaaattgcc cgtacccccacccccgttcgccctgcggcgccccgtgtcatcaaataccgtcaccccgtt agcggggaaacctgggacggccaaggccaacatcctgaatggttgcgccaagcgttactc aaagaaggttggcgcgttgacgagctcaagcccgccaaccaaaactctaccgaacattga

DBGET integrated database retrieval system