Vibrio fluvialis: AL536_21560 Help Entry AL536_21560       CDS       T04379                                  Name (GenBank) cell division protein ZapB   KO K09892   cell division protein ZapB Organism vfl  Vibrio fluvialis Brite KEGG Orthology (KO) [BR:vfl00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vfl03036]     AL536_21560 Chromosome and associated proteins [BR:vfl03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     AL536_21560 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB PspA_IM30 Nuf2_DHR10-like YabA DUF7491 Syntaxin Dor1 APG6_N DUF7237 TMF_TATA_bd GAS ERM_helical Ax_dynein_light HAUS-augmin3 Dynamin-like_hel_bact DUF4795 COG3_N DUF3450 DivIC Spc7 CsiV YwqH-like SKA2 betaPIX_CC CENP-Q NPV_P10 Mod_r UPF0242 DUF465 DUF4337 DGCcoil DUF724 Mis12 DUF2203 Seryl_tRNA_N Prefoldin DUF2205 JIP_LZII Herpes_UL6 CtIP_N DUF1664 Peptidase_A25 HAUS6_N V_ATPase_I CLZ 5_nucleotid AAA_13 BRE1 FapA ATG14 GrpE DUF4140 NUDE_C Motif Other DBs NCBI-ProteinID:  AMF95922 UniProt:  A0AAX2LJI3 LinkDB All DBs Position 2:2995261..2995503 Genome browser AA seq 80 aa AA seqDB search MSFEVLEQLEAKIQTAVDTIALLQMEVEELKEEKVKLTEEANELKASREALEQRAQQIQQ EHTAWQERIRNLLGKMDDVE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcttttgaagtactagaacaactagaagcaaaaatccaaaccgcggttgatacaatc gcgttgctgcaaatggaagttgaagagctaaaagaagaaaaagtgaagctgactgaagaa gcaaacgagctgaaagccagccgtgaagctctggagcagcgcgctcagcaaattcaacaa gaacacacggcatggcaagagcgtattcgcaatctgctgggtaaaatggacgacgtggaa taa

DBGET integrated database retrieval system