Vibrio furnissii: vfu_A00579 Help Entry vfu_A00579        CDS       T01680                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism vfu  Vibrio furnissii Brite KEGG Orthology (KO) [BR:vfu00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vfu03036]     vfu_A00579 Chromosome and associated proteins [BR:vfu03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     vfu_A00579 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB PspA_IM30 Nuf2_DHR10-like YabA Syntaxin APG6_N Dor1 DUF7491 TMF_TATA_bd DUF7237 SKA2 ERM_helical GAS DUF3450 HAUS-augmin3 Ax_dynein_light DUF4795 Mod_r YwqH-like Seryl_tRNA_N CsiV COG3_N Dynamin-like_hel_bact Spc7 DUF465 Mis12 DUF4337 DUF2203 UPF0242 NPV_P10 CENP-Q CtIP_N DivIC V_ATPase_I DUF349 DUF1664 5_nucleotid FapA NUDE_C AAA_13 zf-C4H2 Motif Other DBs NCBI-ProteinID:  ADT85787 LinkDB All DBs Position 1:603615..603857 Genome browser AA seq 80 aa AA seqDB search MSFEVLEQLEAKIQTAVDTIALLQMEVEELKEEKVKLVEEANELKASREALEQRSQQIQQ EHTAWQERIRNLLGKMDDVE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcttttgaagtactagaacaactagaagcaaaaatccaaaccgcggttgatacaatc gcattactgcaaatggaagttgaagagctgaaagaagagaaagtgaaactggtcgaagaa gcgaacgagctgaaagcgagccgtgaagcactagagcaacgttctcaacaaattcaacaa gaacacactgcatggcaagagcgtattcgcaacctgctgggcaaaatggacgacgtggaa taa

DBGET integrated database retrieval system