Virgibacillus sp. SK37: X953_12105 Help Entry X953_12105        CDS       T03219                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism vir  Virgibacillus sp. SK37 Pathway vir01100   Metabolic pathways vir01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:vir00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     X953_12105    00074 Mycolic acid biosynthesis     X953_12105   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     X953_12105 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 Guanylate_cyc DUF7080 DUF1493 HLH Motif Other DBs NCBI-ProteinID:  AIF43790 UniProt:  A0A075JQ52 LinkDB All DBs Position complement(2212375..2212608) Genome browser AA seq 77 aa AA seqDB search MADVFDRVKAIIVDRLDVEEEKITMEASFKDDLDADSLDVVELVMELEDEFDMEIADEEA EKINTVGDAVNYINSLQ NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggcagatgtatttgatcgtgttaaagcaattattgtagatcgtcttgacgtagaagaa gaaaaaataacaatggaagcatcttttaaagatgatcttgatgcagattcattagacgtt gttgagcttgttatggagcttgaagatgaatttgatatggaaatcgctgatgaagaagct gaaaaaattaatacagtaggtgatgctgtaaactacataaatagtttacaatag

DBGET integrated database retrieval system