Vitreoscilla sp. C1: ADP71_22020 Help Entry ADP71_22020       CDS       T05336                                  Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism vit  Vitreoscilla sp. C1 Pathway vit01100   Metabolic pathways vit01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:vit00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     ADP71_22020    00074 Mycolic acid biosynthesis     ADP71_22020   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     ADP71_22020 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding PP-binding_2 DUF7080 EutQ DUF1896 DUF1493 Motif Other DBs NCBI-ProteinID:  AUZ05606 UniProt:  A0A2L0PN35 LinkDB All DBs Position complement(1692491..1692724) Genome browser AA seq 77 aa AA seqDB search MENIEQRVKKIVAEQLGVNEAEVKNESSFQEDLGADSLDIVELVMALEEAFDTEIPDEEA ENITTVQQAIDFLTAAE NT seq 234 nt NT seq  +upstreamnt  +downstreamnt atggaaaatatcgaacagcgcgtaaagaaaattgttgctgaacaattgggtgtgaatgaa gctgaagtgaaaaacgaatcttcattccaagaagacttgggcgctgactctttggacatc gttgaattggttatggctttggaagaagctttcgatactgaaattcctgatgaagaagca gaaaacatcactactgtacaacaagctatcgacttcttgacagctgctgagtaa

DBGET integrated database retrieval system