Vibrio parahaemolyticus RIMD 2210633: VP0246 Help Entry VP0246            CDS       T00120                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism vpa  Vibrio parahaemolyticus RIMD 2210633 Brite KEGG Orthology (KO) [BR:vpa00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vpa03036]     VP0246 Chromosome and associated proteins [BR:vpa03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     VP0246 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB PspA_IM30 YabA Nuf2_DHR10-like DUF7237 Dor1 Dynamin-like_hel_bact DUF7491 CENP-F_leu_zip ERM_helical HAUS-augmin3 APG6_N Ax_dynein_light Alanine_zipper She9_MDM33 Tup_N THOC7 Syntaxin Mod_r Muted DUF2203 Spc7 DUF3450 Prefoldin DUF4337 Herpes_UL6 DUF4164 TMF_TATA_bd TTC3 NPV_P10 DUF724 ADIP MctB COG3_N AAA_13 KfrA_N Prefoldin_2 Prominin DUF4407 ATG14 5_nucleotid DUF4140 OmpH FapA DUF2205 XhlA MCU Motif Other DBs NCBI-ProteinID:  BAC58509 UniProt:  Q87T24 LinkDB All DBs Position 1:258096..258338 Genome browser AA seq 80 aa AA seqDB search MSFEVLEQLESKIQTAVDTITLLQMEVEELKEDKVKLEAEANELRSQREDLEQKAQQAQQ EHAQWQERIRALLGKMDEVE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcttttgaagtactagaacaactagaatctaaaattcaaactgcagttgacacaatc actcttcttcagatggaagttgaagagctgaaagaagacaaagtaaaactagaagcagaa gcaaacgagcttcgttctcaacgtgaagatctagagcaaaaagctcagcaagctcagcaa gagcacgcacagtggcaagagcgcattcgtgcactacttggcaaaatggacgaagtggaa taa

DBGET integrated database retrieval system