Vibrio atlanticus: VS_2905 Help Entry VS_2905           CDS       T00812                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism vsp  Vibrio atlanticus Brite KEGG Orthology (KO) [BR:vsp00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:vsp03036]     VS_2905 Chromosome and associated proteins [BR:vsp03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     VS_2905 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Nuf2_DHR10-like PspA_IM30 YabA Dynamin-like_hel_bact APG6_N DUF7491 betaPIX_CC ERM_helical Dor1 DUF3450 Syntaxin HAP1_N CCDC113_CCDC96_CC CtIP_N HAUS-augmin3 NET2A CENP-F_leu_zip ATG16 Mod_r GAS HALZ CCDC106 NUDE_C TMF_TATA_bd ADIP Tup_N DUF2203 DUF2004 Mis12 DUF724 Muted NPV_P10 JIP_LZII SKA2 DUF1664 LCD1 Herpes_UL6 UPF0242 Seryl_tRNA_N DUF4337 HR1 bZIP_1 YwqH-like CsiV COG3_N AAA_13 Spc7 DUF349 CENP-Q SPAM Sipho_Gp157 OmpH FapA 5_nucleotid DUF2968 TolA_bind_tri zf-C4H2 DUF2205 Motif Other DBs NCBI-ProteinID:  CAV20202 UniProt:  B7VLN0 LinkDB All DBs Position 1:complement(3059481..3059723) Genome browser AA seq 80 aa AA seqDB search MSFEVLEQLEAKIQTAVDTIALLQMEVEELKEEKQALATEAGELKASRHELEQKTQQMQE EHSAWQDRIRNLLGKMDDVE NT seq 243 nt NT seq  +upstreamnt  +downstreamnt atgtcttttgaagtactagagcagctagaagcaaaaattcaaacagcagtagatacaatt gcacttcttcaaatggaagtggaagagcttaaagaagagaaacaagcactagcaacagaa gctggtgagcttaaagcaagccgtcacgagctagagcaaaaaactcagcaaatgcaggaa gagcattcagcatggcaagatcgcatccgtaaccttcttggtaaaatggatgacgtagag taa

DBGET integrated database retrieval system