Wolbachia endosymbiont of Delia radicum: L2227_05920 Help Entry L2227_05920       CDS       T08243                                  Symbol acpP Name (GenBank) acyl carrier protein   KO K02078   acyl carrier protein Organism wej  Wolbachia endosymbiont of Delia radicum Pathway wej01100   Metabolic pathways wej01110   Biosynthesis of secondary metabolites Brite KEGG Orthology (KO) [BR:wej00001]  09100 Metabolism   09103 Lipid metabolism    00061 Fatty acid biosynthesis     L2227_05920 (acpP)    00074 Mycolic acid biosynthesis     L2227_05920 (acpP)   09110 Biosynthesis of other secondary metabolites    00998 Biosynthesis of various antibiotics     L2227_05920 (acpP) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  PP-binding DUF7080 PP-binding_2 Ribosomal_L50 DUF6246 Motif Other DBs NCBI-ProteinID:  UJQ20696 LinkDB All DBs Position 1193820..1194080 Genome browser AA seq 86 aa AA seqDB search MNSELAKSTREDIEEKVKKIILEHISKDVEKFNSSSKLSEHGTDSLDAVEIIMAAEEEFG IEIPDEDAQKMETMEQIVEYINNKKG NT seq 261 nt NT seq  +upstreamnt  +downstreamnt gtgaatagcgaactagcaaagagcactagagaagacatagaagaaaaagtaaaaaagatt atactagagcacattagtaaggatgtagagaaattcaacagctcttcaaagctttcggag catggtacagacagtttagatgcagttgaaatcatcatggcggcagaagaagagttcgga atagaaattccagatgaagacgcacaaaaaatggaaactatggagcaaatagttgagtac attaataataaaaaaggctaa

DBGET integrated database retrieval system