Wenzhouxiangella sp. AB-CW3: IC757_03955 Help Entry IC757_03955       CDS       T08427                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism wez  Wenzhouxiangella sp. AB-CW3 Brite KEGG Orthology (KO) [BR:wez00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:wez03036]     IC757_03955 Chromosome and associated proteins [BR:wez03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     IC757_03955 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  COG3_N Dynamitin DUF4407 ZapB GAS YabA CENP-H Nuf2_DHR10-like Mod_r Taxilin NET2A DUF7491 TSC22 SKA2 Sec8_N UPF0242 KIP1 SlyX DUF948 Retinal DivIC DUF2203 SWIRM-assoc_1 FapA APG6_N EMP24_GP25L HAUS-augmin3 UPF0449 Motif Other DBs NCBI-ProteinID:  QOC23312 UniProt:  A0A7H4GPK0 LinkDB All DBs Position 933144..933371 Genome browser AA seq 75 aa AA seqDB search MDSLQETTGDLDRLQQRLSELLELLNRLEEENNSLRARQESLVAERATLVQRNEEARSRV EGMIERLKALEEAGT NT seq 228 nt NT seq  +upstreamnt  +downstreamnt atggactcgctgcaagaaacgacgggagatctggatcggttgcaacagcggctctcggag ctgctggagctgctcaaccggctggaggaagagaacaattcactgcgtgcccgacaggag tccctggtggccgaacgggccacgctggtgcagcgcaacgaggaagcgcgatcgcgggtc gaaggcatgattgagcgactcaaggcactcgaagaggcgggcacgtga

DBGET integrated database retrieval system