Wenzhouxiangella sp. AB-CW3: IC757_03955 Help Entry IC757_03955       CDS       T08427                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism wez  Wenzhouxiangella sp. AB-CW3 Brite KEGG Orthology (KO) [BR:wez00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:wez03036]     IC757_03955 Chromosome and associated proteins [BR:wez03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     IC757_03955 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  COG3_N Dynamitin DUF4407 GAS ZapB YabA CENP-H Nuf2_DHR10-like Mod_r Taxilin NET2A HH_AprE Rod_CreS YfjT_2 DUF7491 TSC22 Mistic MYCBP_helical DUF7900 HHO5_N SKA2 Sec8_N CC_Bre1 SlyX UPF0242 KIP1 MTUS1_CCDC69_CC1 Retinal DUF948 SWIRM-assoc_1 DivIC DUF2203 ZapB_rel APG6_N FapA EMP24_GP25L HAUS-augmin3 Motif Other DBs NCBI-ProteinID:  QOC23312 LinkDB All DBs Position 933144..933371 Genome browser AA seq 75 aa AA seqDB search MDSLQETTGDLDRLQQRLSELLELLNRLEEENNSLRARQESLVAERATLVQRNEEARSRV EGMIERLKALEEAGT NT seq 228 nt NT seq  +upstreamnt  +downstreamnt atggactcgctgcaagaaacgacgggagatctggatcggttgcaacagcggctctcggag ctgctggagctgctcaaccggctggaggaagagaacaattcactgcgtgcccgacaggag tccctggtggccgaacgggccacgctggtgcagcgcaacgaggaagcgcgatcgcgggtc gaaggcatgattgagcgactcaaggcactcgaagaggcgggcacgtga

DBGET integrated database retrieval system