Wenzhouxiangella marina: WM2015_1044 Help Entry WM2015_1044       CDS       T04011                                  Name (GenBank) hypothetical protein   KO K09892   cell division protein ZapB Organism wma  Wenzhouxiangella marina Brite KEGG Orthology (KO) [BR:wma00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:wma03036]     WM2015_1044 Chromosome and associated proteins [BR:wma03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     WM2015_1044 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB CENP-H COG3_N Dynamitin GAS Taxilin Matrilin_ccoil YabA Herpes_UL7 Crescentin GapR_DNA-bd FlgN BLOC1_2 NET2A IFT57 DUF6244 DUF7491 Med9 ARM_TT21_2nd Mod_r SlyX DUF948 DUF724 PMC2NT SKA2 Tropomyosin Complex1_49kDa ATG14 DUF2203 KIP1 DivIC UPF0242 CDK5RAP3 DUF3450 Occludin_ELL TSC22 Sigma70_ner Cauli_AT Prefoldin_2 ERM_helical TMF_TATA_bd DUF7605 FliT RNase_Y_N Troponin HAUS6_N Motif Other DBs NCBI-ProteinID:  AKS41421 UniProt:  A0A0K0XUX5 LinkDB All DBs Position 1234265..1234489 Genome browser AA seq 74 aa AA seqDB search MESLQETSSALDRLQQRLREMLERIRRLEEENRSLHTRQESLVSERAQLVQRNEEARERV EAMIERLKALENAG NT seq 225 nt NT seq  +upstreamnt  +downstreamnt atggaatcgttgcaagagaccagctcggcgctggaccgtcttcagcagcgtctgcgcgag atgctggagcgcattcggcggctggaagaagagaatcgatccctgcacacacgccaggaa tccctggtgtccgagcgggctcagctggtccagcgcaacgaggaggcccgcgagcgggtg gaggccatgatcgagcgtctcaaggcgctagagaacgcggggtag

DBGET integrated database retrieval system