Xanthomonas citri pv. citri 306: XAC3407 Help Entry XAC3407           CDS       T00084                                  Name (GenBank) conserved hypothetical protein   KO K09892   cell division protein ZapB Organism xac  Xanthomonas citri pv. citri 306 Brite KEGG Orthology (KO) [BR:xac00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:xac03036]     XAC3407 Chromosome and associated proteins [BR:xac03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     XAC3407 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Herpes_BLRF2 bZIP_1 Taxilin YabA FAZ1_C Dynamitin SKA2 Stathmin DUF7491 APG6_N Glutaredoxin2_C DUF3450 bZIP_2 DUF7603 DivIC DUF2203 Motif Other DBs NCBI-ProteinID:  AAM38250 UniProt:  A0AAI8ETU1 LinkDB All DBs Position 4014669..4014890 Genome browser AA seq 73 aa AA seqDB search MDNAAALAQIRALAARVEALVERTQRLTDENRSLRHQQEQLIGERSQLLTKNEQARSRVE AMIARLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggacaacgctgccgccctcgctcagatccgcgcactcgccgcccgcgtggaggcgttg gtggagcgtacccaacggctcaccgacgagaatcgcagcttgcgtcatcaacaggagcaa ctcatcggcgagcgctcgcaactgttgaccaagaacgagcaggcgcgctcgcgggtggaa gcgatgatcgcccgcctgaagtcattggagcagcacacgtga

DBGET integrated database retrieval system