Xanthomonas citri pv. citri mf20: J172_03583 Help Entry J172_03583        CDS       T03781                                  Name (GenBank) TIGR02449 family protein   KO K09892   cell division protein ZapB Organism xcf  Xanthomonas citri pv. citri mf20 Brite KEGG Orthology (KO) [BR:xcf00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03036 Chromosome and associated proteins [BR:xcf03036]     J172_03583 Chromosome and associated proteins [BR:xcf03036]  Prokaryotic type   Chromosome partitioning proteins    Divisome proteins     J172_03583 BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  ZapB Herpes_BLRF2 bZIP_1 Taxilin YabA FAZ1_C Dynamitin SKA2 Stathmin DUF7491 APG6_N Glutaredoxin2_C DUF3450 bZIP_2 DUF7603 DivIC DUF2203 Motif Other DBs NCBI-ProteinID:  AJZ10121 UniProt:  A0A0U5FI03 LinkDB All DBs Position 4014662..4014883 Genome browser AA seq 73 aa AA seqDB search MDNAAALAQIRALAARVEALVERTQRLTDENRSLRHQQEQLIGERSQLLTKNEQARSRVE AMIARLKSLEQHT NT seq 222 nt NT seq  +upstreamnt  +downstreamnt atggacaacgctgccgccctcgctcagatccgcgcactcgccgcccgcgtggaggcgttg gtggagcgtacccaacggctcaccgacgagaatcgcagcttgcgtcatcaacaggagcaa ctcatcggcgagcgctcgcaactgttgaccaagaacgagcaggcgcgctcgcgggtggaa gcgatgatcgcccgcctgaagtcattggagcagcacacgtga

DBGET integrated database retrieval system